9/15/20 (week 2)

 

Bile salt activated lipase

Cameron Siqueiros

Glendale Community College

 

This domain is found repeated at the C-terminus (C-tail) of bile salt-activated lipase, where is O-glycosylated.

 

Locus – BD014117     3018 bp           DNA    Linear             Pat 27-AUG-2002

 

Accession number - BD014117

 

Version – BD014117.1

            

Comment OS   Homo sapiens (human)
            PN   JP 2001112468-A/1
            PD   24-APR-2001
            PF   08-SEP-2000 JP 2000274215
            PR   04-APR-1990 US       504635,12-JUN-1990 US       537426 PI
            JORDAN J N TAN, WANG CI SOON
            PC   C12N9/20//A23C9/152, C12N15/09, C12N15/00
            CC   Recombinant bile acid salt activated lipase
            FH   Key             Location/Qualifiers
            FT   source          1..3018
            FT                   /organism='Homo sapiens (human)'.
 
 
Are there discrepancies?
 
Yes, there are some discrepancies between the previous database or at least I believe there are. Some of the values were different based off the domain name and the nucleotide name was different from the last database.

 

Question: Are there any results in a species other than Homo sapiens that has a low E-value, high percent identity, and high percentage of query cover? 

 

No, only homo sapiens even appear even with included other organisms

 

 

Primer pair 1

 

Sequence (5'->3')

Forward primer   TTTTCGATTCAACGGAGTGGC

Reverse primer   CCCAACACAACCAGTTGCAG

Product length     665

 

 

Primer pair 2

 

Sequence (5'->3')

 

Forward primer    TTTTTCGATTCAACGGAGTGGC

Reverse primer    GGCAGTCTTCATCCCCGTAG

Product length      983


Comments

Post a Comment

Popular posts from this blog

February 3rd (Week 1)

Image
This semester I am going to try and finish a few games and practice on other aspects of programming and modeling. This first project I am working on is a 2-D game and I am going for a pixel art style so it should be easier to animate and create items for the game. This first week I watched a tutorial got a nice pixel editor and started creating a tiles to use for the game. I created tiles that are repeatable without showing too much of a pattern. This helps make levels easier because I am able to reuse textures and make maps without putting in too much effort. I also created dungeon walls which are also repeatable. I then opened unity and started creating a tilemap which is a built in unity function which allows me to place down the new tiles I created on a grid and snaps them into place allowing for a quick map editor. I am just creating a small level to test mechanics and get the core gameplay functions working. I hope to create a few levels and have a dungeon crawler rogue lite game...
Read more

10/9/2020 (Week 5)

  Bile salt activated lipase Cameron Siqueiros Glendale Community College   Protein – P19835 (Bile salt-activated lipase)   Description - Bile salt-activated lipase is a major triglyceride, cholesterol ester and vitamin ester hydrolytic enzyme contained within pancreatic and lactating mammary gland secretions. It requires bile salts for activation. The biological process of bile salt activated lipase is known as lipid metabolic process.   Molecular function – hydrolase activity acting on ester bonds.   Function – to catalyze the hydrolysis of a wide range of substrates including cholesteryl esters, phospholipids, lysopholipids, di-acylglycerols, tri-acylglycerols, and fatty acid esters of hydroxy fatty acids or (FAHFAS). Preferentially hydrolyzes FAHFAs with the ester bond further away from the carboxylate. Unsaturated FAHFAs are hydrolyzed quicker than saturated FAHFA. Plays an important role in complete digestion of dietary lipids and their...
Read more